This is a working overview of copper(II) complex, written for readers who want more than a one-paragraph summary but less than a textbook.
This page was last updated on 2026-07-14 and is reviewed periodically as new material appears.
Mechanistic accounts focus on how the complex delivers copper and how the released peptide interacts with the extracellular matrix. Copper is an essential cofactor for lysyl oxidase and other enzymes involved in collagen and elastin cross-linking, and GHK is one of several peptides able to carry the metal. Reported effects include altered gene expression in fibroblasts and changes in matrix metalloproteinase activity, although many of these findings come from cell culture rather than whole organisms. The relative contribution of the peptide backbone, the copper ion, and downstream copper metabolism is not fully resolved.
GHK-Cu is a coordination complex formed between the tripeptide glycyl-L-histidyl-lysine and a copper(II) ion. The peptide sequence is conventionally written as Gly-His-Lys, abbreviated GHK. Copper binds through the imidazole nitrogen of histidine, the alpha-amino group, and a deprotonated amide nitrogen, producing a square-planar geometry. The complex carries a net positive charge near physiological pH and is intensely blue in aqueous solution. The metal-free peptide is often written simply as GHK, while the copper-bound form is written GHK-Cu.
The compound was first isolated from human plasma by the biochemist Loren Pickart in 1973. Early work identified it as a factor that altered the behavior of cultured liver cells, and later studies linked it to connective tissue and wound-related processes. Reported plasma concentrations fall markedly between roughly age twenty and age sixty, a pattern that generated interest in copper peptide biology. Whether that decline has functional consequences remains an open question, because differences observed across age groups do not by themselves establish causation. Research interest later expanded into cosmetic and tissue-culture settings.
Material described as GHK-Cu appears in several distinct markets, including cosmetic ingredients, laboratory reagents, and consumer products, and the quality expectations attached to each differ. A certificate of analysis generally reports peptide purity by chromatography, copper content, appearance, and residual solvents or counterions. Counterion identity matters, because the complex is usually supplied as an acetate or a similar salt, and the counterion contributes to the measured mass. Independent verification of sequence and metal stoichiometry is advisable when a material is used for quantitative work. Batch-to-batch variation is common and should be documented rather than assumed negligible.
Copper peptide solutions tend to resist degradation better than many free peptides, because the bound metal protects the N-terminus and reduces susceptibility to some peptidases. Backbone hydrolysis, oxidation of the histidine imidazole ring, and photochemical reactions remain the principal degradation routes. Aqueous solutions are generally most stable near neutral to mildly acidic pH, while strongly alkaline conditions accelerate hydrolysis. Light exposure is usually avoided, since both the peptide and the copper center can take part in photochemical processes. Stability data published by suppliers often describe short-term behavior rather than multi-year shelf life.
| Property | Value | Notes |
|---|---|---|
| Molecular formula | C14H22CuN6O4 as the complex | Free peptide is C14H24N6O4 |
| Molecular weight | About 402 g/mol | Free peptide is about 340 g/mol |
| Appearance | Blue solid or blue solution | Color from copper d-d transitions |
| Solubility class | Water-soluble; poor in nonpolar solvents | Ionic character favors aqueous media |
| Common synonyms | Copper tripeptide-1; glycyl-L-histidyl-L-lysine copper | INCI listing uses copper tripeptide-1 |
The International Nomenclature of Cosmetic Ingredients lists the substance as copper tripeptide-1, the name that appears on most topical product labels. Related designations include copper peptide and GHK-Cu, and the hyphenated form is common in research literature. In cosmetics the material is regulated as an ingredient rather than as a drug, so products may reach the market without evidence of the effects claimed for them. Whether those effects are clinically meaningful is an open question, since most supportive data come from laboratory work and small trials.
GHK-Cu is the copper complex of the tripeptide glycyl-L-histidyl-L-lysine, a short sequence found naturally in human plasma, saliva and urine. Loren Pickart reported the isolation of the free peptide in 1973 while studying factors that influenced the growth of aged liver cells in culture. The peptide was later shown to bind copper(II) with high affinity, and the metal-bound form became the focus of most subsequent research. Its concentration in circulation declines markedly with age, a pattern that is well documented, though the physiological consequences of that decline remain debated.
The peptide portion consists of three amino acids: glycine, histidine and lysine. Copper(II) coordinates through the imidazole nitrogen of histidine, the alpha-amino group of glycine and a deprotonated amide nitrogen of the backbone, producing a roughly square-planar geometry. This arrangement gives the complex its characteristic blue-to-violet colour and helps it resist dissociation in water. Reported stability constants are high, although values differ between studies because of differences in ionic strength and measurement method.
Identity and purity are assessed mainly by reversed-phase high-performance liquid chromatography with ultraviolet detection, often paired with mass spectrometry to confirm the expected mass. Copper content is measured separately by inductively coupled plasma optical emission spectrometry or atomic absorption spectroscopy, because the peptide assay alone does not establish the metal-to-peptide ratio. Visible spectroscopy provides a rapid check on complex integrity through the absorption band in the visible region. Agreement between the peptide assay and the copper assay is the practical test of whether a sample is the intended complex rather than a mixture.
Aqueous solutions of GHK-Cu are less stable than the dry powder. The peptide backbone is vulnerable to hydrolysis at extreme pH, and copper can be stripped from the complex by strong chelating agents such as EDTA or citrate. Oxidising agents and high concentrations of ascorbic acid can reduce copper(II) and change the complex, which is one reason formulators often keep such ingredients in separate phases. How quickly these changes occur under real storage conditions depends on pH, buffer, temperature and packaging, and quantitative data on the subject are limited.
Dry material is normally held cold, commonly at -20 °C for long-term storage and 2 to 8 °C for working quantities, protected from light and moisture. Vials should be allowed to reach room temperature before opening so that condensation does not form on the powder. In liquid formulations the complex is generally kept near neutral to slightly acidic pH, because strongly alkaline conditions favour precipitation of copper hydroxide. Antioxidants or chelate-stabilising excipients are often added, though the specific approaches are proprietary and rarely published in detail.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
== Overview == The series focuses on Olivia Pope and her crisis management firm, Olivia Pope & Associates, and its staff, as well as staff at the White House in Washington D.C. as political scandals occur and they must try to deal with them.
December 28, 1967: Authorization of contraception by the Neuwirth Law; however, its implementation decrees would not be published until 1971. January 24, 1968: Decree on common provisions applicable to civil servants in the active services of the national police: unless an exception is made, a woman cannot be appointed to a position within the active services. May 24, 1969: Decree setting the amount of the single salary allowance and the stay-at-home mother's allowance. June 4, 1970: In the Civil Code, "joint parental authority" replaces "paternal authority," and "both spouses jointly ensure the moral and material guidance of the family." July 15, 1970: Law concerning the École Polytechnique, which notably allows women to take the entrance exam and sets the conditions for their employment after graduation. August 26, 1970: Founding of the Women's Liberation Movement (MLF), marked by the laying of a wreath "to the wife of the unknown soldier" on the Tomb of the Unknown Soldier beneath the Arc de Triomphe in Paris. December 23, 1970: Decree increasing the rate of daily rest allowances for maternity insurance under the general social security system. April 5, 1971: Publication of the "Manifesto of the 343" in Le Nouvel Observateur: signed by 343 women — including celebrities — declaring they had undergone an abortion and demanding the right to free abortion. April 16, 1971: Ministerial order regarding the Women's Work Committee, replacing the Study and Liaison Committee on Women's Work Issues. June 10, 1971: Law on parentage.
Meat from sheep features prominently in the cuisines of several Mediterranean cultures including Greece, Croatia, Turkey, North Africa, Jordan, and the Middle East, as well as in the cuisines of Iran and Afghanistan. In Greece, for example, it is an integral component of many meals and of religious feasts such as Easter, like avgolemono and magiritsa. It is also popular in the Basque culture, both in the Basque country of Europe and in shepherding parts of the Western United States, where shepherds of Basque descent have been active since the 1850s. In the United States, the Navajo have incorporated mutton and lamb into their traditional cuisine since the introduction of sheep by Spanish explorers and settlers in the 17th century, replacing wild turkey and venison and creating a pastoral culture. In Northern Europe, mutton and lamb feature in many traditional dishes, including those of Iceland, Norway and the United Kingdom. Mutton is popular in Australia. Lamb and mutton are very popular in Central Asia and in certain parts of China, where other red meats may be eschewed for religious or economic reasons. Barbecued mutton is also a specialty in some areas of the United States, chiefly Owensboro, Kentucky, and Canada. Meat from sheep is generally consumed far less in the US than in many European, Central American and Asian cuisines. Average per-capita consumption of lamb in the United States is only 400 grams (14 oz) per year. In Australia, the leg of lamb roast is considered to be the national dish.
=== Zinc === A 2012 cross-sectional study found an association between zinc deficiency and depressive symptoms among women, but not men, and a 2013 meta-analysis of 17 observational studies found that blood zinc concentrations were lower in depressed subjects than in control subjects. A 2012 meta-analysis found that zinc supplementation as an adjunct to antidepressant drug treatment significantly lowered depressive symptom scores of depressed patients. The potential mechanisms underlying the association between low serum zinc and depression remain unclear, but may involve the regulation of neurotransmitter, endocrine and neurogenesis pathways. Zinc supplementation has been reported to improve symptoms of ADHD and depression. A 2013 review found that zinc supplementation may be an effective treatment in major depression.
Sources: en.wikipedia.org
== Controversies == Al-Fawzan has attracted criticism for a number of public statements and religious opinions. In 2003, he was quoted as saying that "slavery is a part of Islam" and that Muslims who deny this are ignorant and not scholars, comments that drew criticism for contradicting some contemporary interpretations of Islamic law. He has also described public demonstrations as haram, characterizing them as practices of non-Muslims that can lead to division and violence. In 2010, he called for a boycott against Adil al-Kalbani, who had stated that music was not haram (forbidden in Islam). The campaign was a fiasco, as the mosque was overcrowded during Adil al-Kalbani's next sermon. In 2011, opposing the Saudi Ministry of Justice's proposal to set a minimum age for girls' marriage, he reportedly issued a legal opinion authorizing fathers to marry off their daughters "even if they are still in the cradle". In 2014, Saleh al-Fawzan denied reports that he issued a fatwa banning open buffets, clarifying on his website that he had only commented that food of unspecified quantity should not be sold without specification. His statement addressed restaurants where customers pay a fixed price for unspecified portions. In 2015, he was quoted as saying that “Muslims must set aside games and frivolity and take up God’s work. They must not waste their time following games and frivolity, especially not during the blessed month of Ramadan. This is true for Muslims in general, and the younger generation in particular...
A PSMA scan is a nuclear medicine imaging technique used in the diagnosis and staging of prostate cancer. It is carried out by injection of a radiopharmaceutical with a positron or gamma emitting radionuclide and a prostate-specific membrane antigen (PSMA) targeting ligand. After injection, imaging of positron emitters such as gallium-68 (68Ga), copper-64 (64Cu), and fluorine-18 (18F) is carried out with a positron emission tomography (PET) scanner. For gamma emitters such as technetium-99m (99mTc) and indium-111 (111In) single-photon emission computed tomography (SPECT) imaging is performed with a gamma camera. As well as the diagnosis and staging of prostate cancer, PSMA imaging can also be used to assess suitability for and plan treatment with external beam radiotherapy and PSMA-targeted radionuclide therapy.
=== Towards type IV === Zoltan Galántai notes that neither Kardashev nor Sagan thought to extend the scale and define a Type IV (which would use the energy of an entire universe). They simply did not envision a civilization capable of manipulating its environment on the largest possible scale (about 14 billion parsecs). The concept of a Type IV supercivilization approaches divine possibilities, enabling the creation of, and travel through, alternate universes of such a civilization's own design, although the latter possibility is reserved for a Type V civilization by Carrigan. The fraction of energy captured by a civilization capable of powering itself on a black hole could also be used to classify civilizations.
== Sources == Baikiain has been found in diverse natural sources including dates, African teak (Baikiaea plurijuga) wood, and the red algae Serraticardia maxima. Several laboratory syntheses of baikiain and its racemic form have been reported.
The Lowland distillers, who had no opportunity to avoid taxation, complained that untaxed Highland whisky made up more than half the market. The heavy taxation during the Napoleonic Wars gave the illicit trade a large advantage, but their product was also considered better quality, commanding a higher price in the Lowlands. This was due to the method of taxation: malt was subject to tax (at a rate that climbed substantially between the 1790s and 1822). The licensed distillers, therefore, used more raw grain in an effort to reduce their tax bill. The Highland magistrates, themselves members of the landowning classes, had a lenient attitude to unlicensed distillers—all of whom would be tenants in the local area. They understood that the trade supported the rents paid. Imprisoned tenants would not be able to pay any rent. In 1823, Parliament eased restrictions on licensed distilleries with the Excise Act 1823 (4 Geo. 4. c. 94), while at the same time making it harder for the illegal stills to operate. Magistrates found counsel for the Crown appearing in their courts, so forcing the maximum penalties to be applied, with some cases removed to the Court of Exchequer in Edinburgh for tougher sentences. Highland landowners were now happy to remove tenants who were distillers in clearances on their estates. These changes ushered in the modern era of Scotch production: in 1823 2,232,000 gallons of whisky had duty paid on it; in 1824 this increased to 4,350,000 gallons.
Sources: en.wikipedia.org
== Gameplay == The traditional mode of gameplay is Deathmatch; at the start of a round, players must choose a single pistol, a unique weapon, and a special item. Unlike the buy menu in Counter-Strike, these weapons are free and have limited ammunition, which makes tactical usage crucial. The game also includes a "last man standing" mode, which plays like a deathmatch, but without respawning after death. Action Half-life also features a single player mode. Some unique features in this mode include a move called "Adrenaline Rush", similar to Bullet Time.
=== Coagulase === The coagulase test determines whether an organism can produce the enzyme coagulase, which causes the fibrin to clot. Inoculating a plasma test tube with the microbe indicates whether coagulase is produced. A clot indicates the presence of coagulase, while no clot indicates the lack of coagulase.
The involvement of the king's son-in-law Iñaki Urdangarín in the corruption scandal known as the Nóos affair caused enormous damage to the image of the monarchy, as polls immediately reflected. The first official reaction of the Casa del Rey came on December 12, 2011, when it was decided to remove Urdangarín from official acts due to his "non-exemplary" behavior. In the Christmas Message the king spoke of "justice being equal for all". Four days later, Urdangarín was charged and between Saturday 25 and Sunday February 26, 2012, he had to testify before the judge in Palma de Mallorca. Another hard blow to the prestige of the monarchy came two months later, when on April 14, 2012, it was learned that King Juan Carlos had broken his hip on an elephant hunt in Botswana and that he had been rushed to Madrid for surgery. The news sparked a huge controversy that forced the king to apologize when he left the clinic. "I am very sorry. I made a mistake and it won't happen again," he said. On November 21, 2013, the king underwent another hip operation. It was the third surgery in less than a year, and the ninth in the last five. At the first official act in which he intervened, the celebration of Pascua Militar on January 6, 2014, he appeared tired and unwell. Just one day later, the judge of the Nóos affair, José Castro Aragón, charged the infanta Cristina de Borbón for the second time – the first had been dismissed the previous year by the Audiencia de Palma – for money laundering and tax crimes.
==== Study techniques ==== Much of what is known about cellular morphology changes and the effects of Rho proteins comes from the creation of a constitutively active mutated form of the protein. Mutation of a key amino acid can alter the conformation of the entire protein, causing it to permanently adopt a conformation that resembles the GTP-bound state. This protein cannot be inactivated normally, through GTP hydrolysis, and is thus "stuck on". When a Rho protein activated in this manner is expressed in 3T3 cells, morphological changes such as contractions and filopodia formation ensue. Because Rho proteins are G-proteins and plasma membrane bound, their location can be easily controlled. In each situation, whether it be wound healing, cytokinesis, or budding, the location of the Rho activation can be imaged and identified. For example, if a circular hole is inflicted in a spherical cell, Cdc42 and other active Rhos are seen in highest concentration around the circumference of the circular injury. One method of maintaining the spatial zones of activation is through anchoring to the actin cytoskeleton, keeping the membrane-bound protein from diffusing away from the region where it is most needed. Another method of maintenance is through the formation of a large complex that is resistant to diffusion and more rigidly bound to the membrane than the Rho itself.
Galahad is conceived when Elaine gets the court enchantress Dame Brisen to use magic to trick Lancelot into thinking that he is coming to visit Guinevere. Elaine rapes Lancelot through deception but he instantly flees when he realizes what has happened. Galahad is raised by his aunt in a convent, and when he is eighteen, comes to King Arthur's court and begins the Grail Quest. Only he, Percival, and Bors are virtuous enough to achieve the Grail and restore Pelles.
Sources: en.wikipedia.org
It is the copper(II) complex of the tripeptide glycyl-L-histidyl-lysine, a sequence of three amino acids. The copper ion is held by the histidine imidazole, the terminal amino group, and an amide nitrogen. The bound form is distinct from the free peptide in charge, color, and stability.
Copper(II) complexes absorb light in the red part of the visible spectrum, so transmitted light appears blue. The absorption arises from electronic transitions within the copper d-orbitals, which are split by the surrounding ligands. The intensity and exact wavelength shift somewhat with pH, solvent, and ligand arrangement.
The free peptide and the copper-bound complex are studied as separate species and do not always behave the same way in assays. Some reported responses are attributed to copper delivery, while others are attributed to the peptide sequence itself. Which fraction drives a given observation is often unresolved in the published work.
The solid is typically held cold and dry, and solutions are kept for shorter periods because hydrolysis proceeds in water. Repeated freeze-thaw cycles are usually avoided, since they can degrade both the peptide and the complex. Container material and headspace also affect how long a sample remains unchanged.